The frequency and spectrum of PIK3CA mutations in patients with estrogen receptor-positive HER2-negative advanced breast cancer residing in various regions of Russia

Cover Page

Abstract


Relevance. PIK3CA belongs to the top three most frequently mutated genes in breast cancer (BC), especially in estrogen receptor (ER) positive, HER2 negative BC subtype. With an approval of selective PI3K-alpha inhibitor, alpelisib, this alteration has become actionable in ER+HER2- tumors. The frequency and spectrum of PIK3CA alterations in various cohorts is affected by a number of factors, including the distribution of BC expression subtypes, histological types, patient age, and even ethnicity.

Aim. Aim of the current study was to characterize the frequency and spectrum of PIK3CA alterations in Russian BC patients.

Materials and methods. The analysis of PIK3CA exon 7, 9 and 20 mutations was performed in a cohort of Russian ER+HER2- BC patients by a combination of high-resolution melting analysis, allele-specific PCR, and digital droplet PCR.

Results. PIK3CA lesions were identified in 62/206 (30%) patients. Noteworthy, 59/62 (95%) of the identified variants were represented by the three most common p.E542K, p.E545K, and p.H1047R substitutions. The analysis of clinical and morphological characteristics revealed the trends towards association of PIK3CA mutations with older age and more frequent metastatic lung involvement.

Conclusion. The obtained data on the frequency and spectrum of PIK3CA somatic aberrations can be helpful when organizing molecular genetic testing of breast cancer patients and using PI3K inhibitors in Russian population.


Full Text

Введение

В 2020 г. впервые рак молочной железы (РМЖ) занял 1-е место по распространенности среди злокачественных опухолей человека во всем мире [1, 2]. Несмотря на то, что на момент диагноза менее 10% случаев РМЖ имеют отдаленные метастазы, распространенный РМЖ остается одной из ведущих причин смертности от рака у женщин. В течение последнего десятилетия разработаны новые эффективные подходы к терапии всех основных разновидностей РМЖ: внедрены ингибиторы PARP для BRCA-ассоциированного рака и/или РМЖ с дефицитом гомологичной репарации ДНК; новые анти-HER2-препараты для HER2-положительных новообразований; комбинации эндокринной терапии и эверолимуса или ингибиторов CDK4/6 для распространенных эстроген-рецептор-(ER)-позитивных РМЖ [3]. Значимым событием в этой области стал недавний успех исследования SOLAR-1, которое продемонстрировало преимущество добавления селективного ингибитора изоформы PI3K-a, алпелисиба, к стандартной гормональной терапии ER+/HER2-PIK3CA-мутированного распространенного РМЖ, в том числе после прогрессирования на схемах, включающих ингибиторы CDK4/6 [4]. Более того, доклинические и ранние клинические исследования свидетельствуют об эффекте ингибиторов PI3K не только при ER-позитивных карциномах, но и при других категориях РМЖ [5, 6].

Ген PIK3CA кодирует каталитическую субъединицу p110-a киназы PI3K. Нарушения онкогенного сигнального каскада PI3K/Akt/mTOR встречаются практически при всех злокачественных новообразованиях человека, а соматические мутации PIK3CA выявляются примерно в 1/3 опухолей молочной железы [7–9]. Повреждения PIK3CA приводят к разнообразным функциональным последствиям, например, влияют на пролиферацию и выживаемость клеток, метаболические особенности, иммуногенность, предпочтительные зоны метастазирования и даже специфические паттерны роста опухоли, которые можно определить радиологически [10–14]. Мутации PIK3CA являются наиболее частым генетическим дефектом при ER+/HER2- РМЖ (28–47%); при этом они реже встречаются при HER2-позитивных (22–40%) и трижды негативных опухолях (8–18%) [5, 7, 15–17]. Генетические повреждения PIK3CA чаще обнаруживаются в более старшем возрасте [18], и их частота варьирует в разных популяциях [19, 20].

Влияние мутаций PIK3CA на прогноз заболевания неоднозначно. На ранних стадиях РМЖ они, вероятно, являются маркером хорошего прогноза, тогда как при распространенных опухолях связаны с резистентностью к химиотерапии и сниженной выживаемостью [21, 22]. В то же время показано, что мутации PIK3CA ассоциируются с большей продолжительностью жизни при метастатических трижды негативных карциномах, что может быть связано с обогащением этой группы бывшими люминальными опухолями, утратившими экспрессию ER в результате эндокринной терапии [23]. При HER2-позитивном РМЖ генетические нарушения PIK3CA коррелируют с устойчивостью к цитостатической и таргетной терапии [21, 24, 25].

Большая часть повреждений PIK3CA (70–90%) локализуется в нескольких «горячих точках» мутагенеза: в позициях C420 в экзоне 7 (C2-домен); E542, E545 и Q546 в экзоне 9 (спиральный домен) и H1047 в экзоне 20 (киназный домен). Чаще всего встречаются замены p.E542K, p.E545K и p.H1047R [17]. Мутации, затрагивающие разные домены, имеют неодинаковые функциональные последствия и поэтому могут по-разному влиять на биологические свойства опухоли [9]. Так, повреждения в спиральном домене чаще обнаруживаются в дольковых хорошо дифференцированных карциномах, относящихся к люминальному А экспрессионному варианту, в то время как мутации в киназном домене преобладают в других подгруппах РМЖ [26–28].

Необходимо отметить, что в ключевом исследовании SOLAR-1 для детекции мутаций PIK3CA использовался имеющий статус сопутствующей диагностики набор PIK3CA RGQ PCR Kit, который обнаруживает только 11 наиболее частых вариантов мутаций PIK3CA [4]. Такой подход к генотипированию может «упускать» до 25% менее распространенных мутаций [17]. В настоящее время функциональное и прогностическое значение редких мутаций PIK3CA активно изучается [29]. Для мутаций PIK3CA характерна пространственно-временная гетерогенность. Так, иногда отмечаются несоответствие статуса PIK3CA между первичной опухолью и метастатическими поражениями, а также отличия в частоте мутантного аллеля в различных участках первичной опухоли [30]. При прогрессировании опухоли клеточный клон с мутациями PIK3CA может перестать детектироваться, а затем снова появиться в том случае, если активация PIK3CA придает новообразованию лекарственную устойчивость [31, 32]. Подобная гетерогенность делает тестирование PIK3CA технически сложным и может потребовать повторения генетического анализа в процессе лечения.

В нашем исследовании выполнен систематический анализ соматических мутаций PIK3CA при распространенном ER+HER2- РМЖ у российских пациенток.

Материалы и методы

В исследование вошли 206 случаев ER+/HER2- опухолей от пациенток с распространенным РМЖ, получавших лечение в 25 разных городах России. После микродиссекции операционного или биопсийного материала ДНК из него выделялась по опубликованному ранее протоколу [33]. Генотипирование экзона 7 (фрагмент, включающий кодон 420), экзона 9 и экзона 20 PIK3CA выполнялось при помощи плавления ПЦР-продуктов с высоким разрешением (high resolution melting analysis – HRMA). Одновременно пять наиболее распространенных мутаций (p.E542K, p.E545K, p.H1047R, p.H1047L, p.H1047Y) оценивались с помощью аллель-специфической полимеразной цепной реакции (АС-ПЦР). Если АС-ПЦР не обнаруживала мутаций при наличии аномалий в кривых плавления, образцы подвергались секвенированию по Сэнгеру. Если при АС-ПЦР наблюдался неоднозначный результат в отношении одной из трех наиболее частых замен PIK3CA (p.E542K, p.E545K или p.H1047R), образцы анализировались с помощью цифровой капельной ПЦР (digital droplet PCR, ddPCR). Последовательности праймеров и условия реакций приведены в табл. 1.

 

Таблица 1. Методы детекции мутаций в гене PIK3CA

Table 1. Mutation detection methods in the PIK3CA gene

Метод

Последовательности праймеров и меток

Состав ПЦР-смеси

Условия реакции, оборудование

Плавление ПЦР-продукта с высоким разрешением (high resolution melting analysis)

PIK3CAex7F: tgttgaattttccttttgggg

PIK3CAex7R: actggccaaagattcaaagc

PIK3CAex9F: ctagagacaatgaattaagggaa

PIK3CAex9R: cattttagcacttacctgtgac

PIK3CAex20F: ttgcatacattcgaaagaccc

PIK3CAex20R: tgctgtttaattgtgtggaaga

1 μl ДНК, 0,75 u ДНК-полимеразы hot-start, 1X ПЦР-буфер (pH 8,3), 2,5 mM MgCl2, 1X EvaGreen, 200 μМ дНТФ, 0,3 μМ праймеров в общем объеме 20 μl

45 ПЦР-циклов: 95°C – 15 с, 60°C – 30 с, 72°C – 30 с, высокоразрешающее плавление ДНК; CFX96 Thermal Cycler (Bio-Rad); CEQ 8000 (Beckman-Coulter, USA)

АС-ПЦР (мутации PIK3CA p.E542K, p.E545K, p.H1047R, p.H1047L, p.H1047Y)

PIK3CA_E542Kwt: tttctcctgctcagtgatttc

PIK3CA_E542Kmut: tttctcctgctcagtgatttt

PIK3CA_E542com: tctgtaaatcatctgtgaatcc

PIK3CA_E545Kwt: atagaaaatctttctcctgctc

PIK3CA_E545Kmut: atagaaaatctttctcctgctt

PIK3CA_E545com: ggaaaaatatgacaaagaaagc

PIK3CA_H1047wt: tgttgaccagccaccttgat

PIK3CA_H1047R: tgttgaccagccaccttgac

PIK3CA_H1047L: tgttgaccagccaccttgaa

PIK3CA_H1047Y: gttgaccagccaccttgata

PIK3CA_H1047сom: ctggaatgccagaactacaat

1 μl ДНК, 0,75 u ДНК-полимеразы hot-start, 1X ПЦР-буфер (pH 8,3), 2,5 mM MgCl2, 0.2X Sybr Green, 200 μМ дНТФ, 0,3 μМ праймеров в общем объеме 20 μl

45 ПЦР-циклов: 95°C – 15 с, 60°C – 30 с, 72°C – 30 с, плавление ДНК; CFX96 Thermal Cycler (Bio-Rad)

Цифровая капельная ПЦР (digital droplet PCR)

Набор Bio-Rad PrimePCR ddPCR Mutation detection assays (Bio-Rad) для мутаций PIK3CA p.E542K, p.E545K и p.H1047R

В соответствии с рекомендациями производителя набора

В соответствии с рекомендациями производителя набора; оборудование QX100 droplet digital PCR system (Bio-Rad)

 

Сравнение частоты мутаций в разных подгруппах РМЖ выполнено с помощью точного критерия Фишера. U-критерий Манна–Уитни применялся для сравнения возраста на момент постановки диагноза у пациентов с различным статусом PIK3CA.

Результаты

Статус PIK3CA определен в 206 ER+/HER2- РМЖ. У 25 женщин выявлен первично метастатический РМЖ, а в 181 случае прогрессирование заболевания зафиксировано уже после постановки диагноза. Девять (6%) пациентов имели I, 51 (34%) – II, 65 (43%) – III и 25 (17%) – IV стадию заболевания на момент диагноза РМЖ. Средний возраст в когорте составлял 55 лет (от 27 до 77 лет).

Мутации PIK3CA выявлены в 62/206 (30%) случаях. Большая часть мутаций локализовалась в киназном домене (41/62, 66%), а оставшиеся повреждения – в спиральном домене гена (21/62, 34%). Самыми частым вариантами оказались замены PIK3CA p.H1047R (40/62, 65%), p.E545K (11/62, 18%) и p.E542K (8/62, 13%). Также обнаружены три более редких мутации: p.Q546K, p.E545G и p.H1047L. Методом цифровой капельной ПЦР подтверждено присутствие мутаций в 9-м экзоне в 8 случаях и замены p.H1047R в 3 из 4 случаев c пограничными результатами, полученными с помощью АС-ПЦР.

Анализ ассоциаций между наличием, локализацией мутаций PIK3CA и клинико-морфологическими особенностями РМЖ (возраст на момент постановки диагноза, гистология опухоли, стадия, степень дифференцировки, экспрессия Ki67 и т.д.; табл. 2) не выявил каких-либо статистически значимых закономерностей. Тем не менее можно отметить, что мутации PIK3CA обнаруживались чаще у более пожилых пациентов (средний возраст составлял 53 года при отсутствии мутации и 59 лет при наличии замен PIK3CA; p=0,184), а также в случаях без клинических признаков наследственного РМЖ и рака яичников [48/140 (34%) против 14/66 (21%); p=0,073]. Частота мутации PIK3CA была несколько выше в случаях с единичными метастазами в легкое (8/15, 53%), чем в опухолях с метастазами в другие зоны (12/42, 29%; p=0,117). Генетические дефекты в спиральном домене PIK3CA чаще выявлялись в опухолях меньших размеров: их встречаемость достигла 4/32 (44%) в опухолях T1–T2 в сравнении с 2/13 (15%) в карциномах T3–Т4 (р=0,094).

 

Таблица 2. Клинико-морфологические характеристики исследованной выборки РМЖ

Table. 2. Clinical and morphological characteristics of the BC sample studied

Характеристика

PIK3CA WT (n=144)

PIK3CA MUT(n=62)

Значение p (PIK3CA WT vs MUT)

PIK3CA MUT (экзон 9, n=21)

PIK3CA MUT (экзон 20, n=41)

Значение p (мутации в экзоне 9 vs мутации в экзоне 20)

Возраст (медиана, диапазон)

53 (27–77)

59 (31–74)

0,184

61 (31–72)

58 (37–74)

0,897

Гистологический тип

Протоковый рак (n=48)

35 (73%)

13 (27%)

0,237

(Протоковый vs дольковый)

4 (31%)

9 (69%)

1,000

(Протоковый vs дольковый)

Дольковый рак (n=18)

10 (56%)

8 (44%)

2 (25%)

6 (85%)

Другие (n=7)

6 (86%)

1 (14%)

1 (100%)

0 (0%)

ND (n=133)

93 (70%)

40 (30%)

14 (35%)

26 (65%)

Размер первичной опухоли (T)

T1 (n=26)

18 (69%)

8 (31%)

1,000

(T1–T2 vs T3–T4)

3 (38%)

5 (62%)

0,094

(T1–T2 vs T3–T4)

T2 (n=71)

47 (66% )

24 (34%)

11 (46%)

13 (54%)

T3 (n=14)

12 (76%)

2 (14%)

0 (0%)

2 (100%)

T4 (n=32)

21 (66%)

11 (34%)

2 (18%)

9 (82%)

ND (n=63)

46 (73%)

17 (27%)

5 (29%)

12 (71%)

Вовлеченность лимфоузлов (N)

N0 (n=29)

21 (72%)

8 (28%)

0,659

(N0 vs N1–N3)

3 (38%)

5 (62%)

1,000

(N0 vs N1–N3)

N1 (n=52)

39 (75%)

13 (25%)

6 (46%)

7 (54%)

N2 (n=29)

19 (66%)

10 (34%)

3 (30%)

7 (70%)

N3 (n=31)

17 (55%)

14 (45%)

4 (29%)

10 (71%)

ND (n=65)

48 (74%)

17 (26%)

5 (29%)

12 (71%)

Стадия заболевания

I (n=9)

7 (78%)

2 (22%)

1,000

(I–II vs III–IV)

0 (0%)

2 (100%)

0,211

(I–II vs III–IV)

II (n=51)

35 (69%)

16 (31%)

9 (56%)

7 (44%)

III (n=65)

43 (66%)

22 (34%)

7 (32%)

15 (68%)

IV (n=25)

18 (72%)

7 (28%)

1 (14%)

6 (86%)

Неизвестно (n=56)

41 (73%)

15 (27%)

4 (27%)

11 (73%)

Рекуррентный/первично-метастатический рак

Рекуррентный (n=181)

126 (70%)

55 (30%)

1,000

(Рекуррентный vs первично-метастатический

1,000

(ВДП менее или более 5 лет)

20 (37%)

35 (63%)

0,405

(рекуррентный vs первично-метастатический

1,000

(ВДП менее или более 5 лет

ВДП <1 года (n=49)

34 (69%)

15 (31%)

6 (40%)

9 (60%)

ВДП 1–3 года (n=33)

23 (70%)

10 (30%)

4 (40%)

6 (60%)

ВДП 3–5 лет (n=6)

5 (83%)

1 (17%)

0 (0%)

1 (100%)

ВДП >5 лет (n=22)

16 (73%)

6 (27%)

2 (33%)

4 (67%)

ND (n=71)

48 (68%)

23 (32%)

8 (35%)

15 (65%)

Первично-метастатический рак (n=25)

18 (72%)

7 (28%)

1 (14%)

6 (86%)

Степень дифференцировки опухоли

G1 (n=1)

1 (100%)

0 (0%)

0,676

(G1–G2 vs G3)

0 (0%)

0 (0%)

1,000

(G1–G2 vs G3)

G2 (n=23)

13 (57%)

10 (43%)

4 (40%)

6 (60%)

G3 (n=8)

6 (75%)

2 (25%)

1 (50%)

1 (50%)

ND (n=174)

124 (71%)

50 (29%)

16 (32%)

34 (68%)

Индекс Ki67

Низкий (<20%) (n=53)

35 (66%)

18 (34%)

0,547

(Низкий vs высокий)

6 (33%)

12 (67%)

1,000

(Низкий vs высокий)

Высокий (≥20%) (n=66)

48 (73%)

18 (27%)

7 (39%)

11 (61%)

ND (n=87)

61 (69%)

26 (30%)

8 (31%)

18 (69%)

Менопаузальный статус

Пременопауза (n=41)

31 (76%)

10 (24%)

0,564 (Пре- vs

пост-менопауза)

4 (40%)

6 (60%)

1,000 (Пре- vs

постменопауза)

Постменопауза (n=149)

105 (70%)

44 (30%)

16 (36%)

28 (64%)

Другое/ND (n=16)

8 (50%)

8 (50%)

1 (17%)

7 (83%)

Зоны метастазирования (n=72)

Только кости (n=22)

14 (64%)

8 (36%)

0,117

(Легкие vs другие зоны)

3 (38%)

5 (62%)

0,642

(Легкие vs другие зоны)

Только легкие (n=15)

7 (47%)

8 (53%)

2 (25%)

6 (75%%)

Только плевра (n=9)

7 (78%)

2 (22%)

1 (50%)

1 (50%)

Только мягкие ткани (n=5)

5 (100%)

0 (0%)

0 (0%)

0 (0%)

Только отдаленные лимфоузлы (n=1)

1 (100%)

0 (0%)

0 (0%)

0 (0%)

Только печень (n=4)

3 (75%)

1 (25%)

1 (100%)

0 (0%)

Только брюшина (n=1)

0 (0%)

1 (100%)

0 (0%)

1 (100%)

Множественные зоны (n=15)

9 (60%)

6 (40%)

2 (33%)

4 (67%)

Признаки наследственного рака (молодой возраст, множественные опухоли, семейный анамнез)

Есть (n=66)

52 (79%)

14 (21%)

0,073

6 (43%)

8 (57%)

0,524

Нет или ND (n=140)

92 (66%)

48 (34%)

15 (11%)

33 (69%)

Примечание. ВДП – время до прогрессирования, ND – нет данных, WT – опухоли без мутаций, MUT – опухоли с мутациями.

 

Обсуждение

В нашей когорте РМЖ мутации в гене PIK3CA обнаружены в 30% случаев. Эти цифры согласуются с опубликованными данными о частоте повреждений PIK3CA при ER+/HER2- РМЖ (диапазон – 13–62%, среднее значение – 36%, межквартильный интервал – 31–46%) [7]. Спектр выявленных изменений PIK3CA ограничен каноническими «горячими точками» мутаций, при этом абсолютное большинство идентифицированных вариантов (59/62, 95%) пришлось всего на три замены: p.E542K, p.E545K и p.H1047R. Все они могут быть идентифицированы с помощью набора для ПЦР therascreen PIK3CA RGQ, одобренного Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов США в качестве сопутствующей диагностики для алпелисиба. Между тем в нашей выборке в 12 случаях помимо стандартных ПЦР-тестов для подтверждения наличия мутаций пришлось использовать технологию ddPCR. Преобладание исключительно «канонических» мутаций выглядит несколько неожиданным, так как по данным других работ около 8–33% повреждений PIK3CA обычно представлены редкими вариантами, в основном сгруппированными в тех же 7, 9 и 20-м экзонах гена. Выявленный спектр мутаций может отражать соотношение различных подтипов РМЖ в нашей когорте. Опухоли, относящиеся к люминальному B экспрессионному подтипу, характеризуются меньшей частотой и разнообразием мутаций PIK3CA по сравнению с люминальными А новообразованиями [17, 27].

При использовании высокого индекса пролиферации Ki67 (≥20%) в качестве суррогатного маркера для дифференциации люминальных А и B карцином оказалось, что в исследуемой выборке содержится не менее 66/206 (32%) случаев люминального B РМЖ.

В нашей работе обнаружена тенденция к ассоциации между мутациями PIK3CA и метастазами в легкие, о которой недавно сообщалось в исследовании L. Gerratana и соавт. (2020 г.) [14]. Также известно, что мутации PIK3CA ассоциированы со старшим возрастом [18]. Меньшую частоту повреждений PIK3CA у пациентов с признаками наследственного рака в нашей выборке, вероятно, можно объяснить увеличенной долей молодых женщин в этой подгруппе. Связь мутаций в спиральном домене гена с меньшим размером первичной опухоли описана в работе G. Papaxoinis и соавт. (2015 г.) [28].

К ограничениям выполненного исследования можно отнести неполный объем доступных клинико-морфологических данных: например, отсутствие информации об экспрессии Ki67 не позволило дифференцировать люминальный А и люминальный B экспрессионный варианты РМЖ в большей части выборки. Кроме того, проанализирована не вся кодирующая последовательность PIK3CA, и, следовательно, могли быть не обнаружены редкие соматические варианты, локализующиеся за пределами «горячих точек» мутагенеза.

Определение мутации PIK3CA в настоящее время входит в российские и международные стандарты лечения РМЖ и рекомендуется всем пациентам с гормонозависимым HER2-отрицательным распространенным РМЖ при обнаружении первых признаков метастазирования [34, 35].

Заключение

Полученные данные о спектре соматических аберраций PIK3CA могут быть использованы при планировании клинических исследований ингибиторов PI3K в нашей популяции и организации молекулярно-генетического тестирования больных РМЖ. Знание о наличии мутации PIK3CA позволит планировать последующую терапию с применением таргетного препарата алпелисиб, блокирующего PI3K.

Конфликт интересов. Авторы заявляют об отсутствии конфликта интересов.

Conflict of interests. The authors declare no conflict of interest.

About the authors

Tatiana N. Sokolova

Petrov Institute of Oncology

Author for correspondence.
Email: stretanya@yandex.ru
ORCID iD: 0000-0002-0537-7478

Russian Federation, Saint Petersburg

Research Assistant

Svetlana N. Aleksakhina

Petrov Institute of Oncology

Email: abyshevasv@gmail.com
ORCID iD: 0000-0002-2149-7728

Russian Federation, Saint Petersburg

Cand. Sci. (Biol.)

Grigoriy A. Yanus

Petrov Institute of Oncology; Saint Petersburg State Pediatric Medical University

Email: octavedoctor@yandex.ru
ORCID iD: 0000-0002-9844-4536

Russian Federation, Saint Petersburg; Saint Petersburg

Cand. Sci. (Med.)

Aleksandr V. Sultanbaev

Republican Clinical Oncological Dispensary

Email: rkodrb@yandex.ru
ORCID iD: 0000-0003-0996-5995

Russian Federation, Ufa

Cand. Sci. (Med.)

Konstantin V. Menshikov

Republican Clinical Oncological Dispensary

Email: kmenshikov80@bk.ru
ORCID iD: 0000-0003-3734-2779

Russian Federation, Ufa

Cand. Sci. (Med.)

Anna N. Lysenko

Regional Oncology Dispensary

Email: anyutadoctor@yandex.ru

Russian Federation, Stavropol

oncologist

Ruslan A. Zukov

Voino-Yasenetsky Krasnoyarsk State Medical University

Email: zukov_rus@mail.ru
ORCID iD: 0000-0002-7210-3020

Russian Federation, Krasnoyarsk

D. Sci. (Med.), Prof.

Alena V. Zyuzyukina

Voino-Yasenetsky Krasnoyarsk State Medical University

Email: alena-vz@mail.ru
ORCID iD: 0000-0002-6758-4800

Russian Federation, Krasnoyarsk

Cand. Sci. (Med.)

Yulia N. Murunova

Surgut Regional Hospital

Email: murunovayn@surgutokb.ru
ORCID iD: 0000-0003-0299-980X

Russian Federation, Surgut

Cand. Sci. (Med.)

Elena I. Rossokha

Altai Regional Oncological Dispensary

Email: rossokha_e@mail.ru
ORCID iD: 0000-0002-5303-3012

Russian Federation, Barnaul

Cand. Sci. (Med.)

Sergey Y. Bakharev

Altai Regional Oncological Dispensary

Email: bachero@mail.ru
ORCID iD: 0000-0003-0429-8804

Russian Federation, Barnaul

Head of the Department of Pathological Anatomy

Elena A. Basova

Oncology Dispensary

Email: basova_elena68@mail.ru

Russian Federation, Birobidzhan

chief physician

Tatiana A. Kasmynina

Oncology Dispensary

Email: stretanya@yandex.ru

Russian Federation, Birobidzhan

oncologist

Irina S. Shumskaya

Nizhny Novgorod Regional Clinical Oncological Dispensary

Email: medicanns@mail.ru

Russian Federation, Nizhny Novgorod

Cand. Sci. (Med.)

Yana I. Bakshun

Cancer Hospital

Email: mikobacteria@gmail.com
ORCID iD: 0000-0001-8584-6299

Russian Federation, Kostroma

oncologist

Khedi S. Musaeva

Republican Oncology Dispensary

Email: musaeva.onco@mail.ru

Russian Federation, Grozniy

oncologist

Alfia I. Khasanova

Sigal Republic Clinical Oncology Dispensary; Kazan Federal University

Email: haalfy@mail.ru
ORCID iD: 0000-0002-4880-4353

Russian Federation, Kazan; Kazan

Cand. Sci. (Med.)

Vadim N. Dmitriev

Belgorod Oncology Dispensary

Email: vadd@mail.ru

Russian Federation, Belgorod

D. Sci. (Med.)

Marina B. Bolieva

Republican Oncology Dispensary

Email: marina-bolieva1985@mail.ru

Russian Federation, Vladikavkaz

oncologist

Christina H. Gadzaova

Republican Oncology Dispensary

Email: lady.onko@yandex.ru

Russian Federation, Vladikavkaz

oncologist

Oleg L. Petrenko

Kaliningrad Regional Clinical Hospital

Email: Petrenko-oleg78@mail.ru
ORCID iD: 0000-0002-6482-1698

Russian Federation, Kaliningrad

Cand. Sci. (Med.)

Dmitriy A. Maksimov

Tver Regional Clinical Oncology Dispensary

Email: dr.maksimovda@mail.ru

Russian Federation, Tver

oncologist, Head of the Surgical Department

Vladimir I. Vladimirov

Pyatigorsk Oncology Dispensary

Email: vladvlad@megalog.ru
ORCID iD: 0000-0002-7375-8950

Russian Federation, Pyatigorsk

D. Sci. (Med.)

Viktor E. Goldberg

Tomsk National Research Medical Center

Email: goldbergve@mail.ru
ORCID iD: 0000-0003-4753-5283

Russian Federation, Tomsk

D. Sci. (Med.), Prof.

Nataliya O. Popova

Tomsk National Research Medical Center

Email: popova75tomsk@mail.ru
ORCID iD: 0000-0001-5294-778X

Russian Federation, Tomsk

Cand. Sci. (Med.)

Marianna V. Kibisheva

Oncology Dispensary

Email: zareta.alix@yandex.ru

Russian Federation, Nalchik

oncologist

Zaur M. Khamgokov

Oncology Dispensary

Email: zaur0779@inbox.ru

Russian Federation, Nalchik

oncologist

Alexey E. Vasilyev

Orenburg Regional Clinical Oncological Dispensary

Email: vasiliev@rambler.ru
ORCID iD: 0000-0003-0385-6798

Russian Federation, Orenburg

oncologist

Aglaya G. Iyevleva

Petrov Institute of Oncology; Saint Petersburg State Pediatric Medical University

Email: aglayai@inbox.ru
ORCID iD: 0000-0001-5454-5186

Russian Federation, Saint Petersburg; Saint Petersburg

Cand. Sci. (Med.)

Evgeny N. Imyanitov

Petrov Institute of Oncology; Saint Petersburg State Pediatric Medical University

Email: evgeny@imyanitov.spb.ru
ORCID iD: 0000-0003-4529-7891

Russian Federation, Saint Petersburg; Saint Petersburg

D. Sci. (Med.), Prof., Corr. Memb. RAS

References

  1. Available at: https://gco.iarc.fr/today/ Accessed: 19.02.2021.
  2. Sung H, Ferlay J, Siegel RL, et al. Cancer Statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: Cancer J Clin 2021; 0: 1–41. doi: 10.3322/caac.21660
  3. Waks AG, Winer EP. Breast Cancer Treatment: A Review. JAMA 2019; 321 (3): 288–300. doi: 10.1001/jama.2018.19323
  4. André F, Ciruelos EM, Juric D, et al. Alpelisib plus fulvestrant for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative advanced breast cancer: final overall survival results from SOLAR-1. Ann Oncol 2021; 32 (2): 208–17. doi: 10.1016/j.annonc.2020.11.011
  5. Lehmann BD, Bauer JA, Schafer JM, et al. PIK3CA mutations in androgen receptor-positive triple negative breast cancer confer sensitivity to the combination of PI3K and androgen receptor inhibitors. Breast Cancer Res 2014; 16 (4): 406. doi: 10.1186/s13058-014-0406-x
  6. Pascual J, Lim JSJ, Macpherson IR, et al. Triplet Therapy with Palbociclib, Taselisib, and Fulvestrant in PIK3CA-Mutant Breast Cancer and Doublet Palbociclib and Taselisib in Pathway-Mutant Solid Cancers. Cancer Discov 2020. doi: 10.1158/2159-8290.CD-20-0553
  7. Anderson EJ, Mollon LE, Dean JL, et al. Systematic Review of the Prevalence and Diagnostic Workup of PIK3CA Mutations in HR+/HER2- Metastatic Breast Cancer. Int J Breast Cancer 2020; 2020: 3759179. doi: 10.1155/2020/3759179
  8. Khoury K, Tan AR, Elliott A, et al. Prevalence of Phosphatidylinositol-3-Kinase (PI3K) Pathway Alterations and Co-alteration of Other Molecular Markers in Breast Cancer. Front Oncol 2020; 10: 1475. doi: 10.3389/fonc.2020.01475
  9. Willis O, Choucair K, Alloghbi A, et al. PIK3CA gene aberrancy and role in targeted therapy of solid malignancies. Cancer Gene Ther 2020; 27 (9): 634–44. doi: 10.1038/s41417-020-0164-0
  10. Moon WK, Chen HH, Shin SU, et al. Evaluation of TP53/PIK3CA mutations using texture and morphology analysis on breast MRI. Magn Reson Imaging 2019; 63: 60–9. doi: 10.1016/j.mri.2019.08.026
  11. Sobral-Leite M, Salomon I, Opdam M, et al. Cancer-immune interactions in ER-positive breast cancers: PI3K pathway alterations and tumor-infiltrating lymphocytes. Breast Cancer Res 2019; 21 (1): 90. doi: 10.1186/s13058-019-1176-2
  12. Magometschnigg H, Pinker K, Helbich T, et al. PIK3CA Mutational Status Is Associated with High Glycolytic Activity in ER+/HER2- Early Invasive Breast Cancer: a Molecular Imaging Study Using [18F]FDG PET/CT. Mol Imaging Biol 2019; 21 (5): 991–1002. doi: 10.1007/s11307-018-01308-z
  13. Koundouros N, Karali E, Tripp A, et al. Metabolic Fingerprinting Links Oncogenic PIK3CA with Enhanced Arachidonic Acid-Derived Eicosanoids. Cell 2020; 181 (7): 1596–1611.e27. doi: 10.1016/j.cell.2020.05.053
  14. Gerratana L, Davis AA, Polano M, et al. Understanding the organ tropism of metastatic breast cancer through the combination of liquid biopsy tools. Eur J Cancer 2020; 143: 147–57. doi: 10.1016/j.ejca.2020.11.005
  15. Muller KE, Marotti JD. Genotype-phenotype associations in breast pathology: Achievements of the past quarter century. Breast J 2020; 26 (6): 1123–31. doi: 10.1111/tbj.13861
  16. Tray N, Taff J, Singh B, et al. Metaplastic breast cancers: Genomic profiling, mutational burden and tumor-infiltrating lymphocytes. Breast 2019; 44: 29–32. doi: 10.1016/j.breast.2018.12.010
  17. Martínez-Sáez O, Chic N, Pascual T, Adamo B, et al. Frequency and spectrum of PIK3CA somatic mutations in breast cancer. Breast Cancer Res 2020; 22 (1): 45. doi: 10.1186/s13058-020-01284-9
  18. Clifton K, Luo J, Tao Y, et al. Mutation profile differences in younger and older patients with advanced breast cancer using circulating tumor DNA (ctDNA). Breast Cancer Res Treat 2020. doi: 10.1007/s10549-020-06019-0
  19. Omilian AR, Wei L, Hong CC, et al. Somatic mutations of triple-negative breast cancer: a comparison between Black and White women. Breast Cancer Res Treat 2020; 182 (2): 503–9. doi: 10.1007/s10549-020-05693-4
  20. Tao Z, Li T, Feng Z, et al. Characterizations of Cancer Gene Mutations in Chinese Metastatic Breast Cancer Patients. Front Oncol 2020; 10: 1023. doi: 10.3389/fonc.2020.01023
  21. Loibl S, Treue D, Budczies J, et al. Mutational Diversity and Therapy Response in Breast Cancer: A Sequencing Analysis in the Neoadjuvant GeparSepto Trial. Clin Cancer Res 2019; 25 (13): 3986–95. doi: 10.1158/1078-0432.CCR-18-3258
  22. Zardavas D, Te Marvelde L, Milne RL, et al. Tumor PIK3CA Genotype and Prognosis in Early-Stage Breast Cancer: A Pooled Analysis of Individual Patient Data. J Clin Oncol 2018; 36 (10): 981–90. doi: 10.1200/JCO.2017.74.8301
  23. Mosele F, Stefanovska B, Lusque A, et al. Outcome and molecular landscape of patients with PIK3CA-mutated metastatic breast cancer. Ann Oncol 2020; 31 (3): 377–86. doi: 10.1016/j.annonc.2019.11.006
  24. Perez EA, de Haas SL, Eiermann W, et al. Relationship between tumor biomarkers and efficacy in MARIANNE, a phase III study of trastuzumab emtansine ± pertuzumab versus trastuzumab plus taxane in HER2-positive advanced breast cancer. BMC Cancer 2019; 19 (1): 517. doi: 10.1186/s12885-019-5687-0
  25. Guarneri V, Dieci MV, Bisagni G, et al. PIK3CA Mutation in the ShortHER Randomized Adjuvant Trial for Patients with Early HER2+ Breast Cancer: Association with Prognosis and Integration with PAM50 Subtype. Clin Cancer Res 2020; 26 (22): 5843–51. doi: 10.1158/1078-0432.CCR-20-1731
  26. Barbareschi M, Buttitta F, Felicioni L, et al. Different prognostic roles of mutations in the helical and kinase domains of the PIK3CA gene in breast carcinomas. Clin Cancer Res 2007; 13 (20): 6064–9. doi: 10.1158/1078-0432.CCR-07-0266
  27. Cancer Genome Atlas Network. Comprehensive molecular portraits of human breast tumours. Nature 2012; 490 (7418): 61–70. doi: 10.1038/nature11412
  28. Papaxoinis G, Kotoula V, Alexopoulou Z, et al. Significance of PIK3CA Mutations in Patients with Early Breast Cancer Treated with Adjuvant Chemotherapy: A Hellenic Cooperative Oncology Group (HeCOG) Study. PLoS One 2015; 10 (10): e0140293. doi: 10.1371/journal.pone.0140293
  29. Spangle JM, Von T, Pavlick DC, et al. PIK3CA C-terminal frameshift mutations are novel oncogenic events that sensitize tumors to PI3K-α inhibition. Proc Natl Acad Sci U S A. 2020 Sep 29; 117 (39): 24427–33. doi: 10.1073/pnas.2000060117
  30. Dupont Jensen J, Laenkholm AV, Knoop A, et al. PIK3CA mutations may be discordant between primary and corresponding metastatic disease in breast cancer. Clin Cancer Res 2011; 17 (4): 667–77. doi: 10.1158/1078-0432.CCR-10-1133
  31. Ang DC, Warrick AL, Shilling A, et al. Frequent phosphatidylinositol-3-kinase mutations in proliferative breast lesions. Mod Pathol 2014; 27 (5): 740–50. doi: 10.1038/modpathol.2013.197
  32. O’Leary B, Cutts RJ, Liu Y, et al. The Genetic Landscape and Clonal Evolution of Breast Cancer Resistance to Palbociclib plus Fulvestrant in the PALOMA-3 Trial. Cancer Discov 2018; 8 (11): 1390–403. doi: 10.1158/2159-8290.CD-18-0264
  33. Yanus GA, Belyaeva AV, Ivantsov AO, et al. Pattern of clinically relevant mutations in consecutive series of Russian colorectal cancer patients. Medical Oncology 2013; 30 (3): 686.
  34. Клинические рекомендации. Рак молочной железы. 2021. [Klinicheskie rekomendatsii. Rak molochnoi zhelezy. 2021. (in Russian).]
  35. Cardoso F, Paluch-Shimon S, Senkus E, et al. 5th ESO-ESMO international consensus guidelines for advanced breast cancer (ABC 5). Ann Oncol 2020; 31 (12): 1623–49. doi: 10.1016/j.annonc.2020.09.010

Statistics

Views

Abstract - 77

PDF (Russian) - 45

Cited-By


Article Metrics

Metrics Loading ...

PlumX

Dimensions

Refbacks

  • There are currently no refbacks.


Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies